the community site for and by developmental biologists

Wellcome Trust 4-yr (1+3) PhD Programme in Stem Cell Biology & Medicine

Posted by on December 19th, 2013

Organisation: Wellcome Trust – Medical Research Council Cambridge Stem Cell Institute Studentship starting: October 2014 Application Deadline: 10th January 2014 Interviews: 30th & 31st January 2014 Stem cells are defined by the dual capacity to self-renew and to differentiate. These properties sustain homeostatic cell turnover in adult tissues and enable repair and regeneration throughout the lifetime[…]

Intestinal stem cells- from a foetal development perspective

Posted by on December 18th, 2013

My name is Rob Fordham and I’ve just finished my PhD at the Wellcome Trust/MRC Cambridge Stem Cell Institute, University of Cambridge, supervised by Dr Kim Jensen (now Associate Professor at the Biotech Research and Innovation Center (BRIC), University of Copenhagen), and Professor Roger Pedersen.* During my PhD I was fascinated with intestinal development- and[…]

Molecular Genetics in the age of information overload

Posted by on December 18th, 2013

Those of us who are of a certain age can remember standing overwhelmed at the video store, agonizing over which movie to rent. Of course today video stores in the US have been pushed to the brink of extinction by delivery and on-demand services like Netflix, who, ironically, have far more movies to offer. In[…]

iPad App Explores Fetal Development

Posted by on December 18th, 2013

  The Science Picture Company has launched an iPad app that explores pregnancy from a new perspective, Life in the Womb. The app follows the embryological and fetal development through the 40 weeks of pregnancy using a combination of digital illustrations, animations and interactive 3D features. Although Life in the Womb is primarily targeted towards[…]

Development editorial- Developing with the community

Posted by on December 17th, 2013

The following editorial, by Development’s Editor in Chief Olivier Pourquié, was first published in Development.    In recent years, there has been much discussion and some degree of discontent with the current scientific publishing system. While we at Development continue to believe in the basic tenets of academic journal publishing – stringent editorial assessment and pre-publication peer review[…]

In Development this week (Vol. 141, Issue 1)

Posted by on December 17th, 2013

Here are the highlights from the current issue of Development:   GABAB inhibits neural stem cell proliferation Neurotransmitter functions are typically associated with neural function rather than with development, but there is a growing body of evidence suggesting that neurotransmitters may also regulate cell proliferation and differentiation in the nervous system. Recent work has demonstrated[…]

Postdoctoral Research Fellow, Sampath Laboratory, University of Warwick, UK

Posted by on December 17th, 2013

Postdoctoral Research Fellow, Sampath Laboratory, University of Warwick, UK   A postdoctoral fellow position is available in the laboratory of Karuna Sampath in the Division of Biomedical Cell Biology at the University of Warwick, UK.  A key area of research in the laboratory is to understand maternal control of early developmental processes and RNA biology[…]

(Developmental) Biology around the internet- December 2013

Posted by on December 16th, 2013

Here is our monthly round-up of some of the interesting content that we spotted around the internet:   News & Research: – Fred Sanger has sadly passed away. A fitting tribute to him was @edyong209‘s tweet: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC (reads RIP Fred Sanger) – 2 papers published in Cell showed that cellular senescence contributes to embryonic development – Paul[…]

A fruitful visit from INB to INA

Posted by on December 15th, 2013

My name is Daniel Ríos and I am a grad student at the ‘Instituto de Neurobiología (INB)’ from the National Autonomous University of Mexico. However, during this past October I was part of the ‘Instituto de Neurociencias de Alicante (INA)’, from the Miguel Hernandez University, in Spain. Ok, I was there just for a short time working[…]

PhD position. Molecular and functional analysis of cardiac diversification by cell specific genomic approaches

Posted by on December 12th, 2013

We are looking for a highly motivated candidate with knowledge in genetic, developmental biology, biochemistry and molecular biology. Experience in genomic approaches (ChIP-seq, RNA-seq), immuno-purification, bioinformatics and confocal microscopy would be also appreciated. Our GReD (Genetics, Reproduction and Development) Laboratory seeks to understand the molecular and cellular mechanisms that control the formation of a eukaryotic[…]