(Developmental) Biology around the internet- December 2013

Posted by the Node, on 16 December 2013

Here is our monthly round-up of some of the interesting content that we spotted around the internet:

News & Research:

– Fred Sanger has sadly passed away. A fitting tribute to him was @edyong209‘s tweet: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC (reads RIP Fred Sanger)

– 2 papers published in Cell showed that cellular senescence contributes to embryonic development

– Paul Knoepfler’s blog is holding a vote to find the iPS cell paper of the year 2013

– Europe PubMed Central and the British Library are running a science writing competition, and one of the papers you can explain is on developmental biology

– The British Society for Developmental Biology (BSDB) is accepting nominations for the Beddington medal for best PhD thesis of 2013

– Nature News published an editorial on the ongoing stem cell controversy in Italy

– ‘I’m a scientist, get me out of here!’ is holding a developmental biology-themed Q&A in association with the Royal Institution Christmas Lectures, which this year will be given by developmental biologist Alison Woollard.

Weird & Wonderful:

– Do you have spare eppendorfs and tips? Why not get creative and make dinosaurs!

– Christmas is upon us soon, and we have spotted a few science-themed Christmas decorations (and we also decorated the Node logo for Christmas!). Also follow the Royal Institution advent calendar to explore all 23 chromosomes and mitochondrial DNA!

– and a 2011 cover of ‘Genes to Cells’ gives a great example of meow’tosis!

Beautiful & Interesting images

– Explore the labs of Nobel Prize winners in detail with these 360° images

– A smiley cell was one of the featured images of the EMBO 2014 calendar

Videos worth watching

– The winners of the ‘Dance your PhD’ competition were announced

– We spotted this bitter-sweet song about the first day in the lab:

– and Bruno Vellutini created a great video showing the life of a sea biscuit: