The community site for and by
developmental and stem cell biologists

MRC DTA 4-Year PhD Programme in Stem Cell Biology and Medicine

Posted by , on 19 December 2013

Closing Date: 15 March 2021

 

Wellcome Trust - Medical Research Council Cambridge Stem Cell Institute

Organisation: Wellcome Trust – Medical Research Council Cambridge Stem Cell Institute

Studentship starting: October 2014

Application Deadline: 10th January 2014

Interviews: 14th February 2014

We invite applications from committed and creative candidates for a 4 year MRC DTA PhD studentship. This studentship is aimed at individuals who have a clear idea of their preferred research topic and supervisor and will commence their PhD project in Year 1.

Stem Cell Biology

Stem cells are defined by the dual capacity to self-renew and to differentiate. In adult tissues stem cells sustain homeostatic cell turnover and enable repair and regeneration throughout the life time of the organism. In contrast, pluripotent stem cells are generated in the laboratory from early embryos or by molecular reprogramming. They have the capacity to make any somatic cell type, including tissue stem cells.

Stem cell research aims to identify and characterise which cells are true stem cells, and to elucidate the physiological, cellular and molecular mechanisms that govern self-renewal, fate specification and differentiation. This research provides new foundations for biomedical discovery, biotechnological and biopharmaceutical exploitation, and clinical applications in regenerative medicine.

Cambridge Stem Cell Community

The Cambridge Stem Cell Institute is exceptional in the depth and diversity of research in both fundamental and translational Stem Cell Biology. The Institute provides a dynamic and interactive research community with over 50 PhD students. Choose from over 30 participating host laboratories using a range of experimental approaches in different tissues and diseases http://www.stemcells.cam.ac.uk/researchers/.

Programme Outline

During the first year students will enter their host lab to commence their PhD research and in addition will join with other PhD students to:

i) study fundamental aspects of Stem Cell Research through a series of group discussions led by leaders in the field;

ii) learn a variety of techniques, such as advanced imaging, flow cytometry, and analysis of complex data sets.

Students will complete their PhD research and thesis submission over years 2-4.

Please note applicants must meet the MRC funding eligibility requirements – please check the eligibility requirements at http://www.mrc.ac.uk/Fundingopportunities/Applicanthandbook/Studentships/Eligibility/index.htm 

To Apply: visit http://www.stemcells.cam.ac.uk/careers-study/otherstudentships/ for full details.

Any questions? Email: cscr-phd@cscr.cam.ac.uk

 

Thumbs up (No Ratings Yet)
Loading...

Tags: , , , , , , , , ,
Categories: Jobs

Navigate the archive

Use our Advanced Search tool to search and filter posts by date, category, tags and authors.

MRC 4-yr PhD Programme in Stem Cell Biology and Medicine – ‘Physical Biology of Stem Cells’

Posted by , on 19 December 2013

Closing Date: 15 March 2021

Wellcome Trust - Medical Research Council Cambridge Stem Cell Institute

Organisation: Wellcome Trust – Medical Research Council Cambridge Stem Cell Institute

Studentship starting: 01 October 2014

Application Deadline: 1st April 2014

Interview Date: 29th April 2014

Programme Overview: This studentship is targeted to applicants with a Physical Sciences, Mathematical or Computational Sciences background, who are interested in applying their training to aspects of stem cell biology.

This programme provides students with an opportunity to spend time in three different labs during their first ‘rotation’ year, before deciding where to undertake their thesis work for years 2-4.

Physical Biology of Stem Cells: Stem cells are defined by their dual capacity to self-renew and differentiate into somatic cells. Great inroads have been made towards understanding how stem cells generate tissue and sustain cell turnover in tissue. At this time most of the inroads have been made by studying the individual biochemistry of the stem cell; much less progress has been made in understanding their function across scales – from molecules to tissue – or how they interact with their physical environment.

In studying the physical biology of stem cells, the aim is to identify and characterise the importance of physical, chemical, mathematical, and engineering considerations in the function of stem cells. This could include mathematical modelling of homeostasis in tissues, engineering controlled environments to control stem cell function, imaging and biotechnology, using single molecule approaches to study molecular interactions, systems biology, or investigating the importance of the stem cell’s response to forces in its environment.

The research generated by the MRC studentships should provide new foundations for biomedical discovery, biotechnological and biopharmaceutical exploitation, and clinical applications in regenerative medicine.

Qualification Eligibility: We welcome applications from those who hold (or expect to be awarded) a relevant first degree at the highest level. You should have a passion for scientific research, specifically with a Physical Sciences, Mathematical or Computational Sciences background.

Financial Support: All applicants must meet the MRC funding eligibility requirements outlined at http://www.mrc.ac.uk/Fundingopportunities/Applicanthandbook/Studentships/Eligibility/index.htm

To Apply: Please visit http://www.stemcells.cam.ac.uk/studentships/phy-biol/ for full details. Please note you will be required to complete and submit a departmental application form, a copy of current CV, provide two references and upload a copy of your transcripts as part of the application process.

Visit http://www.physbio.group.cam.ac.uk/ for details of the current Cambridge Physical Biology network.

Any questions? Email: cscr-phd@cscr.cam.ac.uk

Thumbs up (No Ratings Yet)
Loading...

Categories: Careers, Education, Jobs

Wellcome Trust 4-yr (1+3) PhD Programme in Stem Cell Biology & Medicine

Posted by , on 19 December 2013

Closing Date: 15 March 2021

Wellcome Trust - Medical Research Council Cambridge Stem Cell Institute
Wellcome Trust – Medical Research Council Cambridge Stem Cell Institute

Organisation: Wellcome Trust – Medical Research Council Cambridge Stem Cell Institute

Studentship starting: October 2014

Application Deadline: 10th January 2014

Interviews: 30th & 31st January 2014

Stem cells are defined by the dual capacity to self-renew and to differentiate. These properties sustain homeostatic cell turnover in adult tissues and enable repair and regeneration throughout the lifetime of the organism. In contrast, pluripotent stem cells are generated in the laboratory from early embryos or by molecular reprogramming. They have the capacity to make any somatic cell type, including tissue stem cells.

Stem cell biology aims to identify and characterise which cells are true stem cells, and to elucidate the physiological, cellular and molecular mechanisms that govern self-renewal, fate specification and differentiation. This research should provide new foundations for biomedical discovery, biotechnological and biopharmaceutical exploitation, and clinical applications in regenerative medicine.

Cambridge Stem Cell Community
The University of Cambridge is exceptional in the depth and diversity of its research in Stem Cell Biology, and has a dynamic and interactive research community that is ranked amongst the foremost in the world. By bringing together members of both the Schools of Biology and Medicine, this four year PhD programme will enable you to take advantage of the strength and breadth of stem cell research available in Cambridge. Choose from over 30 participating host laboratories using a range of experimental approaches and organisms.

Programme Outline
During the first year students will:

i) perform laboratory rotations in three different participating groups working on both basic and translational stem cell biology;

ii) study fundamental aspects of Stem Cell Biology through a series of teaching modules led by leaders in the field;

iii) learn a variety of techniques, such as advanced imaging, flow cytometry, and management of complex data sets.

Students are expected to choose a laboratory for their thesis research by June 2015, and will then write a research proposal to be assessed for the MRes Degree in Stem Cell Biology. Students will then commence a 3 year PhD. 

Visit http://www.stemcells.cam.ac.uk/careers-study/studentships/ for full details

Any questions? Email: cscr-phd@cscr.cam.ac.uk

Thumbs up (No Ratings Yet)
Loading...

Tags: , , , , , , , , ,
Categories: Jobs

Intestinal stem cells- from a foetal development perspective

Posted by , on 18 December 2013

My name is Rob Fordham and I’ve just finished my PhD at the Wellcome Trust/MRC Cambridge Stem Cell Institute, University of Cambridge, supervised by Dr Kim Jensen (now Associate Professor at the Biotech Research and Innovation Center (BRIC), University of Copenhagen), and Professor Roger Pedersen.* During my PhD I was fascinated with intestinal development- and here I hope to convince you why this is of interest not just to developmental biologists!

 

The mature mammalian intestinal epithelium is comprised of villi, lined with absorptive enterocytes, protruding into the lumen, and proliferative crypt compartments invaginated into the underlying mesenchyme. The mature intestinal epithelium is the most rapidly self-renewing tissue in adult mammals, with a turnover time in the mouse of 3-4 days. We now know that this high rate of cell replenishment is driven by the division of intestinal stem cells sitting at the crypt base, intercalated between Paneth cells. This has made the intestine an excellent model system for studying tissue stem cell biology, in both homeostasis and disease. However, the emergence of this state, with functionally mature tissue stem cells, from its foetal progenitors during development was relatively poorly understood when I started my PhD.

Morphologically, we do know that by E9.0 of mouse development, a sealed gut tube has formed, which progressively lengthens over the subsequent four days. Around E14.5, the pseudostratified epithelium transitions into a simple columnar epithelium, followed by mesenchymal invagination around E15.5 to form nascent villi. Thus, in mice at birth, the intestine is developmentally immature, consisting simply of a series of undulating villi and proliferative intervillus regions. During the first two postnatal weeks, the intervillus regions lengthen into nascent crypts, coincident with the emergence of Paneth cells. Development of the human intestine follows broadly the same sequence of events as in the mouse, except that crypts start to form in utero, during the second and third trimesters. The early postnatal mouse intestine thus provides an interrogatable model system to understand the events that occur in humans during late gestation.

In 2009, methods were devised for the long-term three-dimensional culture of adult intestinal epithelium as organoids. These organoids require Wnt signalling and contain all the major cell types of the adult intestinal epithelium in vivo, including stem cells and Paneth cells (Sato et al., 2009).

By adapting these culture conditions for foetal material, we were able to demonstrate the existence of a rapidly proliferating population of intestinal progenitors that exists prior to the establishment of mature intestinal stem cells. These cells, present in the foetal intestine from E14.5, grow in vitro as cystic Foetal Enterospheres (FEnS). Through subsequent postnatal development, FEnS are replaced by organoids, and beyond around P15 only organoids can be grown. We also found that a similar population of proliferative progenitors exists in the human intestine towards the end of the first trimester (Fordham et al., 2013).

Mouse Foetal Enterospheres (mFEnS), expressing GFP, in 3D cultureMouse Foetal Enterospheres (mFEnS), expressing GFP, in 3D culture. From Fordham et al., Cell Stem Cell (2013)

Thus, an otherwise developmentally transient population can be expanded in vitro, allowing direct comparison between foetal and adult intestinal stem cell populations for the first time. One important finding was that FEnS could grow without the Wnt-augmenting factor R-spondin, and even in the presence of Wnt signalling inhibitors, in stark contrast to adult organoids, which require Wnt signalling. We further demonstrated that canonical Wnt signalling is sufficient to induce the maturation of foetal intestinal progenitors into adult-like organoids (Fordham et al., 2013). Another group, from Brussels, independently described the same population of immature mouse intestinal progenitors. Mustata et al., (2013) showed that the foetal-to-adult conversion could be induced by inhibiting Notch signalling. Together these two findings suggest that the maturation of foetal progenitors proceeds in concert with establishment of the stem cell niche and that intestinal epithelial maturation requires modulation of Wnt and Notch signalling.

Of course this is all very interesting for developmental biologists, and has raised new questions for the intestine field to now address, such as the extent and relevance of heterogeneity within the pool of intervillus cells.

But I believe this also has important implications for the more translational arm of stem cell research. In particular, it is well known that most of the current protocols aiming to generate various tissue types from pluripotent cells tend to result in immature foetal-like populations, rather than functionally mature adult tissues. Indeed, we were able to generate intestinal cells from the directed differentiation of human iPS cells, but these cells displayed more foetal than adult characteristics (Hannan et al., 2013; Fordham et al., 2013). Clearly the conversion of these immature cells into an adult state in vitro will require a much better understanding of tissue stem cell specification during normal development in vivo.

Since the overarching aim of regenerative therapy is replacement of damaged tissue, we were interested in assessing the in vivo potential of immature intestinal cells. Importantly we now had a system, in the form of mouse FEnS, to sufficiently expand immature cells for transplantation experiments. Previous work from Tokyo Medical and Dental University had shown that adult colonic organoids, transplanted into mice with damaged colons, could contribute to regeneration of the colonic epithelium (Yui et al., 2012). Working with the group in Tokyo, we were able to demonstrate that mouse FEnS could similarly contribute to colonic epithelial regeneration following transplantation (Fordham et al., 2013). This proof-of-principle experiment revealed that foetal cells cultured for prolonged periods in 3D culture retain the potential for differentiation into more-mature cell types, perhaps with greater lineage plasticity than adult-derived cells.

Therefore this work should highlight why translational stem cell research should not lose sight of basic developmental biology- and that developmental biology is perhaps not so far removed from translational impact as people think!

 

GFP-expressing mouse FEnS, transplanted into a damaged colon, contribute to epithelial regenerationGFP-expressing mouse FEnS, transplanted into a damaged colon, contribute to epithelial regeneration

Summary of the major findings presented in Fordham et al., Cell Stem Cell (2013)Summary of the major findings presented in Fordham et al., Cell Stem Cell (2013)

 References

Fordham, R.P. and Yui, S. et al., Transplantation of Expanded Fetal Intestinal Progenitors Contributes to Colon Regeneration after Injury. Cell Stem Cell (2013) Dec 5; 13 (6) 734-744

Hannan, N.R.F., Fordham, R.P. et al., Generation of multipotent foregut stem cells from human pluripotent stem cells. Stem Cell Reports (2013) Oct 10; 1 (4); 293-306

Miyoshi, H. and Stappenbeck, T.S. The Young and the Wnt-less: Transplantable Fetal Intestinal Spheroids without Wnts. Cell Stem Cell (2013) Dec 5; 13 (6) 637-638

Mustata, R.C. et al., Identification of Lgr5-independent spheroid-generating progenitors of the mouse fetal intestinal epithelium. Cell Rep. (2013) Oct 31;5(2):421-32

Sato, T. et al., Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature (2009) May 14;459(7244):262-5

Yui, S. et al., Functional engraftment of colon epithelium expanded in vitro from a single adult Lgr5+ stem cell. Nat. Med. (2012) Mar 11;18(4):618-23

This work was funded by the Medical Research Council and Wellcome Trust

*from January 2014, I will be a Postdoctoral Research Fellow in Professor Owen Sansom’s group at The Beatson Institute for Cancer Research, Glasgow

 

Thumbs up (4 votes)
Loading...

Tags: , ,
Categories: Research

Molecular Genetics in the age of information overload

Posted by , on 18 December 2013

Those of us who are of a certain age can remember standing overwhelmed at the video store, agonizing over which movie to rent. Of course today video stores in the US have been pushed to the brink of extinction by delivery and on-demand services like Netflix, who, ironically, have far more movies to offer. In 2006, Netflix offered one million dollars for the best answer to a simple question: how do we present thousands of movie choices in a way that isn’t overwhelming? Netflix knew that their library had something for everyone, and success was just a matter of bringing the most appealing options to their customers’ attention. Today, biologists face a similar problem. An abundance of expression, interaction, and sequence variation data can make the prospect of selecting genes for experimentation daunting. With the prize in this case being a better understanding of disease, can we pre-select genes in a meaningful way?

 

The idea of prioritizing genes for experimental assay is certainly not a new one. However, recent applications of machine learning concepts in biology have allowed predictions of gene function or phenotype to occur on a global scale. Put simply, machine learning is the automatic identification and exploitation of patterns, in this case, patterns of genes that have a phenotype we’re interested in. For example, many learning approaches can be generically classified as ‘guilt-by-profiling’. In these cases, profiles of gene features (e.g. tissue expression, protein domains) are examined for patterns corresponding to genes of a particular function or phenotype. These patterns can then be used to predict additional genes as sharing the same function/phenotype. Re-visiting the Netflix example, you see guilt-by-profiling in action every time a movie is recommended to you, such that features of movies you like are used in a predictive way. Similarly, in guilt-by-association relationships between gene pairs (e.g. co-expression, physical association, genetic interaction) are used to ‘transfer’ a function or phenotype from one gene to another.

 

Learning approaches have been used to prioritize gene functions across virtually all model organisms, and to predict phenotypes in yeast, C. elegans, and various cell lines. However, phenotype prediction had yet to be systematically validated in vivo in any vertebrate.

 

In our work (Musso et al, online in Development this week) we tested a phenotype prioritization scheme in zebrafish. Zebrafish are fast growing and produce hundreds of progeny, allowing scalable experimentation, thus providing sufficient confirmation of our findings. Also, transparency of embryos has allowed observation of hundreds of developmental phenotypes, giving us a large space of potential phenotypes to predict. We mined an existing public database (www.zfin.org) that catalogues the effect of morpholinos (customizable oligonucleotides that can inhibit transcripts of interest during the first days of development) on hundreds of developmental anatomical processes. We then obtained features and relationships for zebrafish genes (tissue expression, expression from microarray experiments, protein domain information, orthology, and protein & genetic interactions), and predicted for over 15,000 zebrafish genes, which would affect each of 338 developmental processes terms upon knockdown.

 

The result of our learning procedure was over 5 million gene-phenotype prediction scores. Filtering these scores based on estimates of precision (fraction of predictions which are correct), we were left with thousands of predictions deemed ‘high-confidence’, spanning nearly 100 phenotypes. Even with the scalability of zebrafish, this was too much to evaluate systematically. We decided to focus on cardiovascular phenotypes, picking one anatomical process term broadly describing cardiovascular function. This term performed well, as did dozens of additional terms describing neuronal, sensory, or reproductive phenotypes. We used morpholinos to disrupt the 16 genes scoring above a 95% precision cutoff, screening the bottom-ranked genes as negative controls. Not knowing what phenotypes to expect, we used a broad semi-quantitative scoring system to evaluate cardiac function and morphology post-disruption.

 

Looking over the results it was instantly clear that test genes were substantially more likely to cause cardiac defects than controls. However, as with any morpholino-based experiment, potential off-target effects were a real concern. After substantial re-screening, we confidently identified 11 genes as causing a cardiac defect upon knockdown. Among these was hspb7, which had been implicated in human heart failure through an unknown mechanism, and tmem88a, which encodes a Wnt-interacting protein but had no known phenotype (at time of submission, several concurrent publications have confirmed the importance of both of these genes during cardiac development).

 

During publication, we strove to make our prediction results as easily available as possible (in addition to the supplement you can find the predictions at www.genemania.org and http://zfunc.mshri.on.ca). While we hope the zebrafish community finds these predictions helpful, we believe there may be a larger context for these results. While we focused on morpholino-mediated phenotypes, our analysis showed that our predictions were just as effective at identifying mutant effects. Additionally, compared to mammalian model organisms, zebrafish have relatively little gene feature information, so this general strategy should be even more effective at directing experimentation in mammalian models. With large-scale phenotype-quantification efforts underway in multiple model organisms, ‘data overload’ presents a tremendous opportunity to increase the pace of gene function discovery.

Thumbs up (4 votes)
Loading...

Categories: Research, Resources

iPad App Explores Fetal Development

Posted by , on 18 December 2013

 

Life in the Womb
New iPad app that explores journey from conception to birth

The Science Picture Company has launched an iPad app that explores pregnancy from a new perspective, Life in the Womb.

The app follows the embryological and fetal development through the 40 weeks of pregnancy using a combination of digital illustrations, animations and interactive 3D features.

Although Life in the Womb is primarily targeted towards expectant parent’s, the app also serves as a valuable tool for doctors, medical students and anyone interested in the science of pregnancy and human development biology.

Demo Video

Website: www.lifeinthewombapp.com

Life in the Womb was developed by The Science Picture Company in collaboration with Redwind Software and in consultation with University College Dublin and The National Maternity Hospital in Ireland. Life in the Womb is now available on iPad for £2.99 in the app store.

Note about author: Michael Grant is the Creative Director and Co-founder of The Science Picture Company.

 

Thumbs up (3 votes)
Loading...

Tags: ,
Categories: Education, Images, News, Resources

Development editorial- Developing with the community

Posted by , on 17 December 2013

The following editorial, by Development’s Editor in Chief Olivier Pourquié, was first published in Development. 

 

In recent years, there has been much discussion and some degree of discontent with the current scientific publishing system. While we at Development continue to believe in the basic tenets of academic journal publishing – stringent editorial assessment and pre-publication peer review – we recognise that we can always improve, and that we should strive to serve our community as best we can. 2013 has seen some changes to the publishing policies of Development (more on which below), and these will continue in the coming year. With new technologies altering the way scientists access and digest research, and with the changes in the developmental biology field – expanding into stem cell science, quantitative biology and other areas – we also need to engage with and expand our community to reflect these changes.

As many of you will be aware, 2013 was a big year for Development in the stem cell field. As a leading journal for developmental biologists, we believe that it is key to maintain and strengthen the links between the stem cell and developmental fields, and we have continued our efforts to reach out to the stem cell community and encourage scientists in this area to publish their best work in Development. Notably, in 2013, we created a new website, ‘Stem Cells and Regeneration’ (stemcells.dev.biologists.org), which gathers together all the stem cell papers published in the journal and provides a simple ‘one-stop shop’ for stem cell scientists; it also includes community news and useful links. The website was launched at the ISSCR Annual Meeting in Boston in June, along with a Special Issue of the journal dedicated to stem cells and regeneration. We are particularly proud of this issue, which gathers excellent opinion pieces and reviews from prominent stem cell scientists and developmental biologists, and which has been enthusiastically received by old and new readers alike. In time, we would like stem cell researchers to come to view Development as their community journal, as we hope that developmental biologists already do. Although it is still early days to evaluate the impact of these various efforts on the journal, we nevertheless have observed very encouraging trends. Notably, papers in the stem cell section of the journal top our lists of most read and most cited articles, and submissions from stem cell scientists continue to increase.

We are also trying to actively promote studies on human development in the journal. Later this year, Austin Smith, Benoit Bruneau and I are organising a Company of Biologists workshop ‘From Stem Cells to Human Development’. We have lined up a spectacular list of speakers and this should be a very exciting meeting – we hope some of you will be able to attend! For more information on this workshop, please see workshops.biologists.com/workshop_sept_2014.html.

This year has seen significant changes in the internal Development community, with two editors stepping down and being replaced, and with changes to the in-house team. Alex Joyner and Shin-Ichi Nishikawa retired from the team of academic editors and we thank them for their great work and support to the journal. We were thrilled to welcome François Guillemot from the National Institute for Medical Research (London, UK) and Benoit Bruneau from the Gladstone Institute (UCSF, USA) as their replacements. François’ work focuses on mouse forebrain development and the regulation of neural lineage. Benoit is a renowned expert in cardiac development who uses both in vivo and stem cell culture approaches to understand gene regulation in the heart. Benoit is also very active on social networks, where Development has also been expanding its profile and community. We have now a facebook page (www.facebook.com/developmentjournal) and are very active on Twitter (@Dev_journal) where you can get updates on our latest content and follow conferences attended by our Executive Editor Katherine Brown and Reviews Editors Seema Grewal and Caroline Hendry. Caroline is our recently recruited Associate Reviews Editor for the stem cell field, who trained with Melissa Little in Australia and with Ihor Lemishka in New York, and who is now very actively involved in our expansion into stem cell science.

In addition to our presence on social media sites, I hope you all know about the Node (thenode.biologists.com), our community blog for developmental biologists. Having done a fantastic job of setting up and running the site for the last three years, Eva Amsen has moved on to new challenges, and the Node is now in the capable hands of Catarina Vicente. The site goes from strength to strength, and I would in particular encourage you to look at our recent series of posts on science outreach (thenode.biologists.com/tag/outreach/) and on ‘A day in the life…’ of labs working on different model organisms (thenode.biologists.com/tag/a-day-in-the-life/). We’re always looking for contributions to the Node: all you need to do is register and get writing!

In addition to these changes to the Development editorial team, we have undertaken a complete overhaul of our editorial board to better reflect the current scope of the journal – the new board can be found on our website (dev.biologists.org/site/misc/edboard.xhtml). As well as expanding our coverage of the stem cell field, we have also recruited new members with a strong background in mathematics and physics to help promote more quantitative approaches in our field, as well as strengthening our representation in fields such as evo-devo and neurobiology. We plan to solicit advice from editorial board members more actively than in the past when considering the suitability of papers for the journal, as well as for other important strategic decisions.

As you can see from the journal content, the new emphasis on stem cell science has not detracted from the more traditional developmental biology field, where we continue to publish exciting research. We are also happy to see that we now receive a steady stream of papers in the evo-devo and quantitative biology fields, which were also recognised as priorities for the journal. The ‘Techniques and Resources’ section of the journal is also growing. Launched in 2011, the purpose of this new section is to publish the description of new techniques or resources such as databases of interest for wide communities of developmental biologists. We are delighted to see that this section has met with a great enthusiasm among the community and its articles are among the most viewed of the journal.

An important aspect of our journal is that it relies on academic editors, who are specialists in their fields, working for a not-for-profit charity: The Company of Biologists. Profits made by the journal are reinvested in the community and serve to support travel fellowships for young researchers and meeting grants to developmental biology societies and other organisations around the world (see www.biologists.com/grants.html), as well as to organise a valuable series of workshops (workshops.biologists.com/index.html). We are proud to be able to support members of our community in this way. We offer our authors a range of options for publication: you can choose either to publish your manuscript under our Open Access option and make it immediately free for the community, or you can publish under our subscription model, in which case there are no publication charges at all, and the article is free to read after 6 months. Moreover, we strive to serve our community by implementing a fair and efficient peer-review process. At present, our average time from initial submission to issue publication is 6 months, and papers rarely go through protracted rounds of revision and re-review. There is a strong commitment on our part at first decision stage, with well over 90% of papers on which a revision is invited being accepted for publication. This implies a serious evaluation of the suitability of the paper at the time of submission and first review, an effort in which our new editorial board will be more actively involved. We have also begun to share reviews on a particular manuscript among the referees in cases where this will help the editor to come to a more balanced decision.

We recognise that publishing is a highly competitive endeavour, and that authors can suffer when their work is scooped by their competitors. To help alleviate this problem, we have now implemented a policy of ‘Scoop protection’: if a competing paper comes out once we have invited a revision on a paper, we won’t reject on grounds of conceptual advance. Researchers in fields such as computational biology are increasingly turning to pre-print servers such as arXiv for the pre-publication deposition of their manuscripts – where they can be viewed by the community at an early stage in the publication process. Although this is not yet common practice in our field, there are members of our community who do make use of such servers, and we believe this number may well grow. We are therefore pleased to announce that we will not consider posting of an article on a pre-print server as prior publication, and would still consider such manuscripts for potential publication inDevelopment. Finally, on the discussion of publishing policies, we are also actively involved in the discussion on journal metrics initiated by the San Francisco Declaration on Research Assessment to limit the use of impact factor in science evaluation and promote the use of a wider panel of more objective measures. To view the text of the declaration and learn more about the initiative you can consult the editorial I wrote on the topic in May 2013 (dev.biologists.org/content/140/13/2643).

I would like to conclude by thanking the board of The Company of Biologists, particularly directors past and present, John Gurdon and Tim Hunt. I am also grateful to theDevelopment Advisory Group: James Briscoe, Cheryll Tickle and Kate Storey, for valuable discussions and support. The team of academic editors deserves great credit for their dedication and enthusiasm for the job, and I thank our editorial board for their engagement and support. I also thank the Development staff: Administrators Jenny Ostler and Debbie Thorpe; Production Editors Colin Davey, Jane Gunthorpe and Lindsay Roberts; the in-house editorial team of Katherine Brown, Seema Grewal, Caroline Hendry and Catarina Vicente; as well as the company’s production department and Publisher Claire Moulton.

Olivier Pourquié, Development Editor in Chief

Thumbs up (3 votes)
Loading...

Categories: News

In Development this week (Vol. 141, Issue 1)

Posted by , on 17 December 2013

Here are the highlights from the current issue of Development:

 

GABAB inhibits neural stem cell proliferation

F1.smallNeurotransmitter functions are typically associated with neural function rather than with development, but there is a growing body of evidence suggesting that neurotransmitters may also regulate cell proliferation and differentiation in the nervous system. Recent work has demonstrated that GABAA receptor signalling can control adult neurogenesis in the mouse. Verdon Taylor and co-workers now investigate a role for GABAB receptors in the adult mouse hippocampus (p. 83), finding that deletion or inhibition of GABAB1 promotes proliferation of neural stem cells (NSCs), whereas GABAB-receptor agonists induce NSC quiescence. These effects of manipulating GABA signalling appear to represent a cell-autonomous function for GABAB receptors in NSCs. The authors propose that GABAB may be part of a crosstalk mechanism between differentiated neurons and the progenitor population, such that neurogenesis is appropriately coordinated with neural activity. While it has yet to be determined how GABA signalling regulates NSC fate, it is increasingly clear that neurotransmitter-mediated signalling in NSCs is an important mechanism by which neurogenesis can be regulated.

 

Tracking the causes of age-related aneuploidy

F1.small-1Chromosome mis-segregation during meiosis leads to aneuploidy, and hence to reduced fertility and birth defects. The frequency of aneuploidy increases in older mothers. Various mechanisms have been proposed to account for this correlation between maternal age and chromosome segregation defects, most placing the emphasis on errors occurring in meiosis I (MI). Keith Jones and colleagues (p. 199) now use sophisticated live imaging of young and aged mouse oocytes to follow individual bivalents through MI to metaphase II (metII) arrest. In aged oocytes, they observe defects in MI such as weakly attached bivalents and lagging chromosomes during anaphase, but surprisingly find no significant defects in chromosome congression or bivalent segregation. Instead, their data suggest that aneuploidy in aged oocytes is primarily a result of premature separation of dyads during meiosis II, likely during assembly of the metII spindle. The authors propose that these errors are a result of cohesion loss during MI, but – in contrast to previous proposals – that the major segregation errors only occur during meiosis II.

 

Why timing matters during segmentation

F1.small-2Vertebrate somites form via a sequential process of segmentation, which proceeds from anterior to posterior. In many species, anterior somites form more quickly than posterior ones, but whether this is functionally important, and how the switch in timing might be controlled, is unknown. Now (p. 158), Takaaki Matsui and co-workers address these issues in zebrafish, where the anterior four somites form every 20 minutes, while more posterior ones form every 30 minutes. They find that this difference in timing is not due to a change in how long a somite takes to form, but rather to the extent of overlap between segmentation periods. Mechanistically, retinoic acid signalling appears to be key to regulating the transition from fast-forming to slow-forming somites, acting via Ripply1 to regulate the clock gene her1. When RA signalling is impaired, there is a specific vertebral defect at the head-to-trunk linkage, indicating the functional importance of this anterior-posterior difference in the rate of somitogenesis.

Controlling expression by nuclear position

F1.small-3Within the nucleus, active gene loci tend to cluster together in the nuclear interior, while inactive genes are often found at the nuclear lamina. On p. 101, Vladimir Botchkarev, Michael Fessing and co-workers find that developmentally regulated gene expression from the epidermal differentiation complex (EDC) – a locus containing genes associated with epidermal barrier formation – is associated with changes in nuclear position. At early stages of mouse development, the EDC is silent and is located at the periphery, but it moves more centrally prior to gene activation and becomes associated with SC35 nuclear speckles – an indication of transcriptional activity. This relocation is dependent on the epidermal transcription factor p63. Moreover, the authors find that p63 directly regulates the expression of the chromatin remodeller Brg1, and that Brg1 is required for the relocation and activation of the EDC. These results underscore the importance of higher order chromatin structure for the regulation of gene expression, and identify a mechanism by which this nuclear organisation can be developmentally regulated.

 

Cargo transport: a complex tale of the kinesin tail

F1.small-4The plus-end directed motor protein Kinesin-1 is a major effector of microtubule-mediated transport, moving a wide range of cargo around cells. How cargo specificity is achieved and how motor transport is regulated are still not fully understood, particularly in in vivo developmental contexts. Isabel Palacios and colleagues (p. 176) make use of the multiple functions of Kinesin-1 in the Drosophila oocyte to analyse how different kinesin heavy chain (KHC) domains contribute to different activities. The authors focus particularly on the tail region, which is involved in auto-inhibition and cargo binding. Although most kinesin functions are impaired in the absence of this region, some appear to be relatively unaffected. Notably, their data suggest that the auto-inhibitory IAK domain has a function independent of its auto-inhibitory activity, while the microtubule binding AMB domain is essential for transport of certain cargoes. Overall, this study showcases the distinct requirements of different cargoes for particular KHC domains – highlighting the diversity of kinesin-mediated transport mechanisms.

 

Regulating stem cell fate with CRISPRe

F1.small-5The ability to manipulate genomes has been significantly advanced by the development of the CRSIPR/Cas9 technology, in which the Cas9 endonuclease is targeted to specific sites in the genome by single-guide RNAs (sgRNA) – short sequences complementary to the genomic locus of interest. This approach has been further developed to allow regulation of gene expression at particular loci (a system referred to as CRISPRe): a catalytically inactive version of Cas9 (dCas9) can be fused to transcription activation (e.g. VP64) or repression (e.g. KRAB) domains and targeted to the desired genomic locus by sgRNA. Now, René Maehr and colleagues (p. 219) apply the CRISPRe system in human pluripotent stem cells. Their work provides a proof-of-principle that dCas9 fused to either VP64 or KRAB can regulate mRNA and protein levels of a gene targeted by sgRNA, with consequent effects on cell differentiation. This technique provides a widely applicable method to control gene expression, and hence manipulate cell fate, in stem cells.

 

PLUS:

 

Sphingosine 1-phosphate signalling

F1crop.posterSphingosine 1-phosphate (S1P) is a lipid mediator formed by the metabolism of sphingomyelin. Recent studies have shown that crucial events during embryogenesis, such as angiogenesis, cardiogenesis, limb development and neurogenesis, are regulated by S1P signalling. Here, Timothy Hla and colleagues provide an overview of S1P signalling in development and in disease.

See the Development at a Glance poster article on p. 5

 

How unique is the human neocortex?

F1crop.largeThe human cerebral cortex is generally considered the most complex organ, and is the structure that we hold responsible for the repertoire of behavior that distinguishes us from our closest living and extinct relatives. At a recent Company of Biologists Workshop, ‘Evolution of the Human Neocortex: How Unique Are We?’ held in September 2013, researchers considered new information from the fields of developmental biology, genetics, genomics, molecular biology and ethology to understand unique features of the human cerebral cortex and their developmental and evolutionary origin.

See the Meeting Review by Zoltan Molnar and Alex Pollen on p. 11

Thumbs up (No Ratings Yet)
Loading...

Categories: Research

Postdoctoral Research Fellow, Sampath Laboratory, University of Warwick, UK

Posted by , on 17 December 2013

Closing Date: 15 March 2021

Postdoctoral Research Fellow, Sampath Laboratory, University of Warwick, UK
 
A postdoctoral fellow position is available in the laboratory of Karuna Sampath in the Division of Biomedical Cell Biology at the University of Warwick, UK.  A key area of research in the laboratory is to understand maternal control of early developmental processes and RNA biology in the context of vertebrate development(see Lim et al., Development 2012; Tran et al., Development 2012, and Kumari et al., eLife, 2013).

Candidates will be enthusiastic, motivated, have a recent PhD degree and a strong understanding of developmental genetics, cell biology and biochemistry, with evidence of high quality output.  Prior experience in the areas of RNA biology, RNA-protein biochemistry, and signaling pathways in development is an advantage.

Please include a full CV, list of referees, and a covering letter with your application summarizing your research experience, future goals, what you can bring to the post and why the post interests you.

 

To apply online:  
http://www2.warwick.ac.uk/fac/med/research/biomedical/jobopportunities
Research Fellow – Post number: 73518-123

Closing date: 16 January 2014

Thumbs up (No Ratings Yet)
Loading...

Categories: Jobs

(Developmental) Biology around the internet- December 2013

Posted by , on 16 December 2013

Here is our monthly round-up of some of the interesting content that we spotted around the internet:

 

News & Research:

– Fred Sanger has sadly passed away. A fitting tribute to him was @edyong209s tweet: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC (reads RIP Fred Sanger)

– 2 papers published in Cell showed that cellular senescence contributes to embryonic development

– Paul Knoepfler’s blog is holding a vote to find the iPS cell paper of the year 2013

– Europe PubMed Central and the British Library are running a science writing competition, and one of the papers you can explain is on developmental biology

– The British Society for Developmental Biology (BSDB) is accepting nominations for the Beddington medal for best PhD thesis of 2013

– Nature News published an editorial on the ongoing stem cell controversy in Italy

– ‘I’m a scientist, get me out of here!’ is holding a developmental biology-themed Q&A in association with the Royal Institution Christmas Lectures, which this year will be given by developmental biologist Alison Woollard.

 

Weird & Wonderful:

the Node Christmas logo 2– Do you have spare eppendorfs and tips? Why not get creative and make dinosaurs!

– Christmas is upon us soon, and we have spotted a few science-themed Christmas decorations (and we also decorated the Node logo for Christmas!). Also follow the Royal Institution advent calendar to explore all 23 chromosomes and mitochondrial DNA! 

– and a 2011 cover of ‘Genes to Cells’ gives a great example of meow’tosis!

 

Beautiful & Interesting images

– Explore the labs of Nobel Prize winners in detail with these 360° images

– A smiley cell was one of the featured images of the EMBO 2014 calendar

 

Videos worth watching

– The winners of the ‘Dance your PhD’ competition were announced

– We spotted this bitter-sweet song about the first day in the lab:
 

 
 
 
– and Bruno Vellutini created a great video showing the life of a sea biscuit:
 

 
 
Keep up with this and other content, including all Node posts and deadlines of coming meetings, by following the Node on Twitter.
 

Thumbs up (1 votes)
Loading...

Tags:
Categories: News, Video