The community site for and by
developmental and stem cell biologists

(Developmental) Biology around the internet- December 2013

Posted by , on 16 December 2013

Here is our monthly round-up of some of the interesting content that we spotted around the internet:

 

News & Research:

– Fred Sanger has sadly passed away. A fitting tribute to him was @edyong209s tweet: CGCATTCCGTTTCGCGAAGATAGCGCGAACGGCGAACGC (reads RIP Fred Sanger)

– 2 papers published in Cell showed that cellular senescence contributes to embryonic development

– Paul Knoepfler’s blog is holding a vote to find the iPS cell paper of the year 2013

– Europe PubMed Central and the British Library are running a science writing competition, and one of the papers you can explain is on developmental biology

– The British Society for Developmental Biology (BSDB) is accepting nominations for the Beddington medal for best PhD thesis of 2013

– Nature News published an editorial on the ongoing stem cell controversy in Italy

– ‘I’m a scientist, get me out of here!’ is holding a developmental biology-themed Q&A in association with the Royal Institution Christmas Lectures, which this year will be given by developmental biologist Alison Woollard.

 

Weird & Wonderful:

the Node Christmas logo 2– Do you have spare eppendorfs and tips? Why not get creative and make dinosaurs!

– Christmas is upon us soon, and we have spotted a few science-themed Christmas decorations (and we also decorated the Node logo for Christmas!). Also follow the Royal Institution advent calendar to explore all 23 chromosomes and mitochondrial DNA! 

– and a 2011 cover of ‘Genes to Cells’ gives a great example of meow’tosis!

 

Beautiful & Interesting images

– Explore the labs of Nobel Prize winners in detail with these 360° images

– A smiley cell was one of the featured images of the EMBO 2014 calendar

 

Videos worth watching

– The winners of the ‘Dance your PhD’ competition were announced

– We spotted this bitter-sweet song about the first day in the lab:
 

 
 
 
– and Bruno Vellutini created a great video showing the life of a sea biscuit:
 

 
 
Keep up with this and other content, including all Node posts and deadlines of coming meetings, by following the Node on Twitter.
 

Thumbs up (1 votes)
Loading...

Tags:
Categories: News, Video

Navigate the archive

Use our Advanced Search tool to search and filter posts by date, category, tags and authors.

A fruitful visit from INB to INA

Posted by , on 15 December 2013

My name is Daniel Ríos and I am a grad student at the ‘Instituto de Neurobiología (INB)’ from the National Autonomous University of Mexico. However, during this past October I was part of the ‘Instituto de Neurociencias de Alicante (INA)’, from the Miguel Hernandez University, in Spain. Ok, I was there just for a short time working on a collaboration project, but I was taken care of so well that it only took a couple of days for me to feel part of the community.

Thanks to a Development traveling fellowship, I visited the María Dominguez lab to start a collaboration project between her lab and Juan Riesgo’s lab, of which I am part of. María has a very solid group working on growth control in the fruit fly. Among other things, her group studies the larval brain as a model to understand tumorigenesis. In the figure below, I show a larval brain lobe stained to reveal neural precursor cells (green). The proliferation of these cells is under control of various signaling networks and transcription factors, and this provides a useful model to understand growth and its regulation. In this internship, we explored the role of tumor suppressor genes during brain tumorigenesis in Drosophila larvae, and wether they act in the same way during neural development in the embryo.

For me, this was a very enriching experience in many different ways. First, this was my first time crossing the Atlantic Ocean, and the longest time I have ever been away from Mexico. Also, I could really experience how science is done everyday in a different country, and third, I had the opportunity to meet great people from other parts of the world that share common interests to mine.

Finally, with this experience I could really see the “universality” of science. Even though it took a while for me to learn even how to use the laundry machine properly at my flat, or when and where would be possible to find an open supermarket, in the lab I felt that I knew exactly what I had to do and how to do it (with some orientation from the people of the lab, of course). In more technical terms, this was a great chance to broaden my PhD thesis and to receive feedback about it, and also to exchange fly stocks, protocols, and conduct lively science discussions. In our group, we will start to characterize the neural phenotype of mutant lines isolated in our lab, both during embryonic development and during larval stages, and keep on collaborating with the Dominguez lab in this same regard. Once again, I thank the Company of Biologists for their support, and I encourage students to take this exceptional opportunity.

A larval brain lobe, neural precursor cells are shown in green, and blue is a counterstain.
A larval brain. Neural precursor cells are shown in green, and blue is a counterstain.

 

Thumbs up (5 votes)
Loading...

Tags: , , , , , , , , , , , ,
Categories: Funding, Lab Life

PhD position. Molecular and functional analysis of cardiac diversification by cell specific genomic approaches

Posted by , on 12 December 2013

Closing Date: 15 March 2021

We are looking for a highly motivated candidate with knowledge in genetic, developmental biology, biochemistry and molecular biology. Experience in genomic approaches (ChIP-seq, RNA-seq), immuno-purification, bioinformatics and confocal microscopy would be also appreciated.

Our GReD (Genetics, Reproduction and Development) Laboratory seeks to understand the molecular and cellular mechanisms that control the formation of a eukaryotic organism from a fertilized egg. CNRS (UMR6293), INSERM (U1103) and two Universities of Clermont (University of Auvergne and Blaise Pascal University) are involved in financing 10 research teams that compose it. These teams analyze surveillance systems and repair that maintain genome integrity. They study how from an undifferentiated cell, divisions and cell differentiation lead to the formation of a harmoniously developed organism. Extending these fundamental aspects, medical approaches aimed at elucidating the genetic program of a healthy cell, identify deregulation of certain diseases, and find appropriate therapy.

Our current goal in the group is the understanding of molecular mechanisms that control the identity of heart and muscle precursors and the acquisition of morphological and functional properties during development . To investigate this we use genomic approaches: microarray, chromatin immunoprecipitation (ChIP ) and modern in vivo imaging approaches in the Drosophila model . Studies in our team have previously allowed to better understand how the heart and muscle progenitors are specified during embryonic development. An important finding was made revealing that the intrinsic and extrinsic regulators of myogenesis and early cardiogenesis were conserved between invertebrates and vertebrates. Ongoing projects aim at a better understanding of i) mechanisms of appendicular myogenesis ii ) specification of muscle stem cells in Drosophila iii ) functions of the target genes of transcription factors ladybird and their roles in migration and acquisition of cell identity iv ) morphogenesis genetic control of the formation of anterior cardiac tube v) establishing of a drosophila model of myotonic dystrophy type I.

Proposed project: The diversification of cardiac cells is accompanied by numerous changes in the expression of genes that allow cells to acquire their own identity and functions. The proposed PhD project is an integral part of a long-term project that aims to improve our understanding of the genetic pathways that control the formation of different types of cardiac cells using new technological developments involving whole genomic approaches in cell type resolution. We will therefore identify the transcriptome specific to each type of cardiac cells and the mechanisms of transcriptional regulation throughout the process of heart cells diversification. There are three main objectives in this study: i) A comparative analysis of transcription in subsets of cardiac cells ii ) A measure of the dynamics of cell – specific translation by isolating mRNA associated with ribosomes in subpopulations of cardiac cells ( TRAP method ( Heiman et al. cell, 2008) ) iii ) Sort the identified candidate and define the molecular signatures that specify different subsets of heart cells at different time windows . All experiments will be performed on Drosophila embryos. The data will then be analyzed by powerful bioinformatics tools available in the team and supplemented by functional analyzes on these candidates.

Related publications:
Jagla, T., Bidet, Y., Da Ponte, J.P., Dastugue, B., and Jagla, K. (2002). Cross-repressive interactions of identity genes are essential for proper specification of cardiac and muscular fates in Drosophila. Development 129, 1037-1047

Junion G, Bataille L, Jagla T, Da Ponte JP, Tapin R, Jagla K. 2007. Genome-wide view of cell fate specification: ladybird acts at multiple levels during diversification of muscle and heart precursors. Genes & development 21: 3163-3180

Junion G, Spivakov M, Girardot C, Braun M, Gustafson EH, Birney E, Furlong EE. 2012.
A transcription factor collective defines cardiac cell fate and reflects lineage history. Cell 148: 473-486

Contract: ANR fundings for 3 years

Contact:
Dr Guillaume Junion
Krzysztof Jagla team
GReD, INSERM U1103, CNRS UMR6293,
University of Clermont-Ferrand
28, Place Henri Dunant
63000 Clermont Ferrand
France
guillaume.junion1atudamail.fr
Tel: +33473178459

Thumbs up (No Ratings Yet)
Loading...

Categories: Jobs

Advantages of exposure

Posted by , on 11 December 2013

I was fortunate go get funding and support to travel to California during my graduate student period. While some similarities between the Norwegian and Californian west coasts made me feel vaguely familiar, the biggest change and the most exciting part of my visit at UCLA has been the inspiration and scientific maturation that comes from exposure to new ideas and excellent research.

In addition to the planned experiments and training sessions planned for my visit, I also wanted to broaden my scientific interest, and have been attending multiple interesting talks and seminars. From plant stem cell self-renewal to chick embryo gradients, the range of exciting science approaches I can learn from and get inspired by is very rewarding. Although not always directly related to my own research or favourite topics, listening to investigators who display genuine curiosity makes all the difference. This is one of the factors that unite scientist globally, our shared interests in exploring, describing and characterizing the world around us.

Before departure from Norway, I anticipated that the number of experiments run and figures prepared would be a central measure of success for my visit. Although it has been important to learn new techniques and discuss my project with the host lab, other parts of my PhD education have also been substantially enriched as a consequence of changing continents. Inspired by a community of talented students, postdocs and young group leaders here at UCLA, the broadened way I approach science and discoveries will be a central part of my continued fascination for biology. Likewise, science communication has also emerged as a novel direction for how I can contribute to public understanding of biology, health and disease. Here, inspiration to think outside the box allows young PhD-students like myself to imagine and consider alternative career paths that remain connected to discoveries and biological insight.

If you have the chance to leave the safety and familiarity of your current research institute, I urge you to go abroad to experience the global interest in exciting science. Don’t focus too much on the experiments you are supposed to do, but allow the new community to broaden you insights and inspire you to think differently about science. Go, explore and share great science!

Thumbs up (3 votes)
Loading...

Tags: , , , ,
Categories: Careers, Education, Lab Life

Mechanisms for asymmetric heart morphogenesis: About Nodal and tissue intrinsic forces

Posted by , on 11 December 2013

Although we all appear symmetrical from the outside, the organization of our internal organs and organ structure are highly asymmetric. Proper asymmetric positioning and patterning of our organs is very important for correct function, and loss of this asymmetry during organ formation can lead to a variety of serious congenital diseases.  Our recent study identifies a new mechanism by which the heart forms an asymmetric structure during embryonic development.

Thus far it was thought that all organs use the same mechanism to develop this left-right asymmetry by responding to the TGF-β-related growth factor Nodal, which is expressed on the left side of the developing vertebrate embryo. Using forward genetic screening in zebrafish for mutants defective in organ laterality we identified the straightforward mutant. Interestingly the straightforward mutant embryos exhibited complete randomization of brain and the visceral organ laterality, while preferential direction of heart looping was maintained. Positional cloning of the mutation underlying the organ laterality defect revealed a loss-of-function mutation in the asymmetrically expressed zebrafish Nodal-related gene southpaw (spaw).

In vertebrates, including zebrafish, the heart starts out as a linear tube that bends to the right and loops asymmetrically to form the mature functional heart. In zebrafish embryos the linear heart tube is also positioned asymmetrically with respect to the midline with the future venous pole positioned ventral to the left eye. In spaw mutant embryos this initial leftward positioning of the heart (named cardiac jogging) is compromised resulting in a midline positioned heart. Despite this cardiac jogging defect in spaw mutant embryos, the majority of the hearts bend to the right forming a normal dextral heart loop. We therefore concluded that (1) Spaw activity is required for cardiac jogging, but cardiac jogging is dispensable for asymmetric heart looping and (2) Spaw is not the only regulator of asymmetric heart looping. Since there are three Nodal-related genes expressed in the zebrafish embryo we examined whether these other Nodal-related proteins could provide asymmetry information to the heart during heart looping and thereby could compensate for the loss of Spaw activity. However, from our experiments we concluded that the other Nodal-related genes are absent from spaw mutant embryos at embryonic stages relevant to heart lateralization. In addition we observed preferred dextral looping in spaw mutant embryos in which Nodal signaling was blocked either chemically or genetically. From these results we concluded that in the absence of Nodal signaling, dextral heart looping in zebrafish embryos is regulated by an alternative mechanism.

heartdishv2Heart looping in a dish. (a) Cartoon showing the procedure of culturing embryonic heart tubes. Linear heart tubes were dissected from tg(myl7:GFP)-positive embryos at 26 hpf, placed into culture medium and incubated further. (b) Images of explanted heart tubes after 24 hours in culture. While control hearts completed dextral-looping after a 24 hours culturing period, treatment of explanted heart tubes with either a myosin II inhibitor (Blebbistatin) or an inhibitor of actin polymerization (Cytochalasin B) prevented normal heart looping. Reproduced with kind permission from Nature Communications.

 

Significantly, we found that this asymmetric development of the heart is mostly independent from external factors or forces from the rest of the embryo. We developed a heart-in-a-dish system that allowed us to culture linear heart tubes dissected from the embryo in a dish.  Linear heart tubes dissected from the embryo retain their ability to loop, and heart looping occurred predominantly in the correct dextral direction. The heart-in-a dish system allowed us to test the effect of various drugs on directional heart looping and we found that inhibiting actin polymerization or non-muscle myosin activity disrupted the looping process. From these results we concluded that the asymmetric development of the heart is regulated by different mechanisms than those governing brain and visceral organ asymmetry – specifically, heart looping is a tissue intrinsic process that requires actomyosin activity.

modelv4 Cartoon illustrating proposed regulation of dextral heart looping by Nodal and actomyosin. In a wild-type situation, combined Nodal signaling and actomyosin activity provide a robust mechanism driving dextral heart looping. In the absence of Nodal signaling, actomyosin activity is sufficient to promote preferential dextral heart looping. In the absence of actomyosin activity, Nodal signaling is not sufficient to promote dextral heart looping. Reproduced with kind permission from Nature Communications.

 

These findings are interesting since in Drosophila, which lack Nodal genes in their genome, asymmetric organ formation is controlled by tissue- and cell-intrinsic mechanisms that require specific components of the cytoskeleton. Similarly, cultured mammalian cells show phenotype-specific left–right asymmetry that is controlled by the cells cytoskeleton. Our findings suggest now that such an intrinsic mechanisms is also important to regulate asymmetric heart development in zebrafish. Indeed, in ancestral vertebrate organisms that exhibit asymmetric embryonic Nodal expression, accompanied by brain and gut asymmetries, no heart asymmetries are observed in the developing embryo. This suggests that ancestrally the heart did not respond to asymmetric Nodal signaling and it is interesting to speculate that heart asymmetry developed independent of asymmetric Nodal.

 

reference:

Noël ES, Verhoeven M, Lagendijk AK, Tessadori F, Smith K, Choorapoikayil S, den Hertog J and Bakkers J. (2013) A Nodal-independent and tissue-intrinsic mechanism controls heart-looping chirality. Nat Commun. 2013 Nov 11;4:2754

Thumbs up (4 votes)
Loading...

Tags: , , , ,
Categories: Research

Why don’t they tell Postdocs this Stuff? – Secrets to a Successful Science Career

Posted by , on 10 December 2013

Some scientists would say that postdoctoral fellows have the most desirable position in the lab. As a postdoc, you have the research experience from your PhD to give you credibility at the bench. You have the independence to run your own project and supervise students, but without the time commitments and administrative duties of a principal investigator. In addition to publishing papers, you can develop your writing by contributing to fellowship and grant proposals and maybe pen a review. These are all types of professional development opportunities that are critical to building your future career. The postdoc is, in essence, a hands-on apprenticeship to curate the next generation of scientific leaders.  But the degree of professional development for the unspoken things, so called “soft skills” that are key to running a successful lab beyond the research bit, is limited.

How do you learn these secrets? In some cases, maybe your supervisor gives you tips. Maybe you read some of the many management books like “At the Helm” or “Lab Dynamics: Management and Leadership Skills for Scientists”. But what if you still have little idea how to hire, manage, motivate, and inspire people to work with you? When faced with the next step beyond postdoc – running your own lab, whether in academia or industry – what can you do to prepare yourself?

Being a group leader may not come with an instruction manual, but training is available if you know where to look for it. For years the EMBO has been offering lab management courses for group leaders and postdocs. These courses are extremely popular – more than half of the 2014 sessions are already booked. The goal of the workshops is to improve confidence in management skills that may be overlooked in standard science career development. As an 2010 EMBO Fellow, I was able to secure a last-minute spot, and last November I spent three days secluded in a hotel outside of Heidelberg sharing ideas with other postdocs also looking to learn tips to make them better future group leaders.

One of the most surprising aspects of the course was the intensity. Spending long hours talking about interpersonal relationships is draining for anyone, especially in a room full of near strangers. At the beginning of the workshop, we learned about ways of communicating and how this plays a role in managing our interactions with our colleagues. Whether you are a graduate student or the director of an institute, how you speak to someone reflects your message and intentions. It also can garner different reactions depending on how it comes across to the listener. We practiced effective ways to address colleagues to garner the best results. (Note: if you turn your nose up at role-playing scenarios and group work, then be prepared to be out of your comfort zone during lab management training!) Communication is at the heart of everything when it comes to being a leader and a manager. This theme held true throughout the rest of the course and is one of the main take-aways.

Another characteristic of an effective scientist (and definitely one for running a successful team of researchers) is good time management. This skill is hardly a secret, and one that we can all improve for ourselves; but group leaders also have to face time management issues and problem solving for others in their labs! How do you handle that and still accomplish what you need to get done? At the workshop, we called this “who’s got the monkey?” When faced with the constant knock at the office door, successful managers help their team members solve their own problems, not by taking the problems onto themselves. The trick is making sure that the “monkey” stays with its original owner and giving the owner the necessary tools to “take care of it.” In other words, if you are going to run a productive lab, you can’t solve every problem yourself – you don’t have time! You must trust and support those who work for you to help move your lab forward.

Finally, and for me the most revealing part of the workshop, was the evaluation and discussion of personality types and how this contributes to management style. Maybe some scientists would dismiss this type of information as trivial, like taking a magazine quiz. But it is crucial to recognize that our inherent differences as individuals does play a role in our science and how we could run our lab. There are factors to consider in how we respond to stress, treat other people, and what our expectations are in professional relationships. Learning that I tend towards the “Helper” personality was eye-opening, both in terms of what I do really well and what I can do better. On a good day, I see the best in those around me and can help them to develop their potential. On a bad day, I tend to be defensive and manipulative. Knowing about ourselves, and who our allies can be in dealing with complicated situations, make us better managers. Knowing about other personalities that exist in the lab also makes us more effective in our interactions with each other. This is a critical point to building a team that enjoys not only doing research, but also working together with one another.

The steps it takes to secure an independent position from a postdoc are daunting. Developing the soft skills to run your lab shouldn’t be intimidating, and learning from management and team-building experts can help.

Thumbs up (13 votes)
Loading...

Tags: ,
Categories: Careers, Events, Lab Life

Outreach competition- find your own science metaphor!

Posted by , on 5 December 2013

Development recently published an article by Ben-Zion Shilo on his recent science outreach project. In this project, Benny aimed to explain concepts of developmental biology to the public by identifying and photographing their equivalent metaphors in the ‘human’ world. For example, the regular spacing of sun umbrellas on the beach can be seen as a metaphor for the lateral inhibition mechanisms underlying the patterning of neuroblasts in the Drosophila epidermis.

 

The competition:

In keeping with our ongoing outreach series, in this new competition, we are asking you to follow Benny’s lead and come up with your own metaphor! We are looking for the best image pair: a scientific image displaying a specific biological concept (such as a cell type specification or cell lineage), and a photograph of its real world metaphor counterpart. As Benny discusses in his article, it need not be a visual metaphor; conceptual metaphors are also fine. The images will be judged on their aesthetics and on how well the real world metaphor can be used to explain the scientific concept.

You don’t have to necessarily work on the scientific concept that you chose and the scientific image submitted does not have to be of your authorship (although you must have permission to publish it). However, the photograph of the real world metaphor must be taken by you. You may submit up to 3 pairs of images.

The winner will win a copy of Benny’s popular science book on his recent project and a £50 Amazon voucher (or currency equivalent).

Judges:

Ben-Zion Shilo, Weizmann Institute of Science, Israel

Nipam Patel, University of California, Berkeley; Development Editor

Thomas Lecuit, Developmental Biology Institute of Marseille; Development Editor

 

To enter the competition:

Send both your images and a short description (50-100 words) of how your chosen metaphor can be used to explain the scientific concept, to thenode@biologists.com. The deadline for this competition is the 28th of February, and the winners will be announced in late March/early April.

 

Fig.1(small)

 

 

Outreach logo new squareThis post is part of a series on science outreach. You can read the introduction to the series here and read other posts in this series here.

 

 

 

Thumbs up (2 votes)
Loading...

Tags: ,
Categories: Images, Outreach

Conveying principles of embryonic development by metaphors from daily life

Posted by , on 5 December 2013

This article was first published in Development, and was written by Ben-Zion Shilo, Weizmann Institute of Science, Israel.

How can the revolution in our understanding of embryonic development and stem cells be conveyed to the general public? Here, I present a photographic approach to highlight scientific concepts of pattern formation using metaphors from daily life, displaying pairs of images of embryonic development and the corresponding human analogy. By making the viewer ‘feel’ like a cell within a developing embryo, the personal experiences resonate with the scientific concepts, facilitating a new type of appreciation.

The field of developmental biology has undergone a revolution in the past three decades. The conserved signaling pathways cells use to communicate with each other during embryogenesis have been elucidated. Recent technological developments include sophisticated genetic tools to interrogate the roles of genes in distinct tissues and specific time windows in a wide range of organisms, as well as new imaging technologies for the dynamic visualization of developmental processes at subcellular resolution. Finally, the identification of stem cells in different organs, and increasing understanding of the means by which these cells differentiate, brings hope that we might be able to recapitulate these processes for regenerative therapies.

This revolution affects us as scientists on a daily basis, but also has wider implications to every human being: from the understanding of how we are formed from embryos and how similar we are to other multicellular organisms, to the medical applications of this knowledge. When asking if the public is aware of these issues, I am disappointed to say that the answer to this question is no. This is mainly because existing channels to communicate these ideas are not sufficient, rather than reflecting a lack of interest in the topic. Any effort in broadening and enhancing public understanding of developmental biology is thus extremely important.

One challenge in presenting science in a popular way is the limited background knowledge of the audience. The presentation, be it a lecture, movie or article, tends to flow in only one direction: the expert ‘takes the audience by the hand’ and guides them through the scientific paradigms presented. By contrast, developing a dialog, whereby the audience would be able to resonate their own life experiences with the new scientific knowledge, might enhance the understanding of the principles and make the process more interactive and intuitive.

The cell is the basic unit in a developing organism, and it is the interaction between cells that drives the orderly process of embryonic development. In many respects, this concept can be compared to a human society, in which rules, communication and interactions between individuals lead to the intricate organization at physical and social levels. By basing a popular presentation on such an analogy, the audience immediately becomes actively involved. People can identify themselves with the developing cells and this association allows them to ‘feel’ the processes from a personal point of view. Interestingly, Robert Hooke first coined the term ‘cell’ in a biological context in 1665 as an analogy to the human world: the cell walls of an oak tree bark under his microscope reminded him of the cells of monks.

How can this analogy be elaborated and presented? In our research, we generate microscopic images that are not only highly informative to the researcher but also exceptionally beautiful. Yet, in the absence of sufficient background knowledge, these images can be largely meaningless to the general public. I have considered the prospects of utilizing such scientific images more effectively for public education, by using them as a tool for presenting analogies between the biological microscopic world and the macroscopic human one. Concentrating on common underlying principles between the two worlds, our intuitive understanding of the human world can be harnessed in order to grasp scientific paradigms of embryonic development.

During the academic year of 2011/2012, I was fortunate to be a fellow at the Radcliffe Institute for Advanced Study at Harvard University, and dedicated my time to developing this concept. The first step was to delineate the major principles of developmental biology in a logical and balanced manner. This process was extremely beneficial and involved many inspiring discussions with members of my lab and other colleagues. Then, with the major concepts in mind, I approached scientific colleagues working on different model organisms, and asked for images that would depict these concepts. It was rewarding to see how responsive the community was, and I ended up with dozens of images and movies, from which I chose the ones that displayed the concepts most clearly, and which I found most aesthetic.

As researchers, our eye is trained to focus on the crucial aspects of an elaborate scientific image, but for the naive observer such images are extremely confusing. For example, a bright auto-fluorescence spot that researchers ignore, may become their focus of attention. Michal Rovner, a renowned Israeli video artist, suggested converting the scientific images to black and white, leaving only the main topic in a single color. Indeed, it became immediately apparent that after this manipulation the scientific images become more effective: they are minimalistic, and appear more as a work of art. The subject ‘jumps out’ at the viewer, be it spaced neuroblasts (Fig. 1, top) or a stem cell niche (Fig. 2, top).

 Fig.1(small)
Figure 1- How cell signaling establishes a repeated pattern. The outer cell layer of the fruit fly pupa displays a regular arrangement of nerve (red) and epidermal (black) cells. All cells are initially equivalent to each other. Yet, random fluctuations in the level at which each cell produces a signal, allow a given cell to accumulate sufficiently high levels to make it a nerve cell. In parallel, this cell instructs its immediate neighbors to become skin cells. Eventually, an ordered array of nerve cells is generated. Top: external cell layer of the fruit fly pupa with regularly spaced nerve cells (red) (S. Yamamoto and H. Bellen, Baylor College of Medicine and Howard Hughes Medical Institute). Bottom: sunshades distributed at regular intervals on a beach at Lefkada island, Greece (B. Shilo). Note: the legends for Figs 1 and 2 represent the original explanations at the exhibit, and are aimed at the broad audience.

 
The next phase was to match the images with human metaphors. The process of thinking about the metaphors proved to be very creative and inspiring. Just like the procedure of defining the main scientific principles, finding the human metaphors was extremely revealing, forcing me to distill the most seminal aspects of scientific paradigms and choose the analogies to illustrate them best. I was mainly looking for a conceptual similarity rather than a visual one, but of course welcomed the possibility of having a visual resemblance. Thus, the regular spacing of sun umbrellas on the beach is both a visual and conceptual metaphor for the mechanisms underlying the patterning of neuroblasts in the Drosophila epidermis (Fig. 1), whereas the yeast ‘mother culture’ used for making bread has only a conceptual resonance to the idea of a stem cell niche (Fig. 2). Similarly, a flashing ‘Pizza’ sign becomes the metaphor for different times of exposure to the Sonic Hedgehog gradient in the limb, and a game of dominos resembles the successive elaboration of pattern in the embryonic axes.

 

Fig.2(small)
Figure 2- Stem cells and their niche. Upon division of a stem cell, one daughter will maintain the stem cell fate, and the other will produce a differentiated progeny. Stem cells are positioned in a restricted spatial niche, providing signals that maintain them in the proliferative, non-differentiated state. Following division, only one progeny is maintained in the niche, whereas the other will move out of the niche and differentiate. Top: once the eye of the zebra fish is specified, cells differentiate and produce neurons that sense light. Retinal stem cells (red) are maintained throughout the animal’s life in a niche, located adjacent to the lens (K. Cerveny and S. Wilson, University College London). Bottom: the live yeast stock termed ‘mother’ is carefully maintained in the bakery. Portions are allocated to produce dough and bread. A fine balance is kept in order to ensure a steady production of bread, while propagating the yeast stock (B. Shilo, Hi Rise Bakery, Cambridge, MA, USA).

 
Given my long-standing interest in photography, I decided to capture these images myself. As with the scientific images, the colorful pictures of the human world may contain too many hues that divert the viewer’s attention from the intended point. Therefore, I converted these pictures to black and white format as well, leaving only the topic of interest in color. By generating a common format for each image pair, the shared concept is visually reinforced. After assembling 35 pairs of images that cover the main concepts I delineated, the project was ready for presentation.

I have developed several means by which the project can be displayed. First, the images can be presented as a photography exhibit (Fig. 3), with a short introduction and a paragraph explaining the concept behind each image pair displayed next to the pictures. The images follow a scientifically logical order, starting with the pathways by which cells communicate during development, and how these allow elaborate patterns to be created. The exhibit then displays the concept of morphogens and evolution of patterns during speciation, followed by the execution of patterning that leads to the formation of tissues and organs. The exhibit ends with stem cells and the promise of induced pluripotent stem cells, and their possible utilization to create new organs. This exhibition has been displayed at the Radcliffe gallery at Harvard, at the Harvard educational portal at Allston (MA, USA) and at the Weizmann Institute of Science in Israel. I was concerned that the short explanations may not be sufficient to draw the audience into the subject matter, in the absence of a deeper explanation or a gallery talk. However, the audience response was extremely rewarding, and the best indication for the success of the approach was that people came to me with new suggestions for metaphors, indicating that they understood the concepts and were able to relate them creatively to their own world.

This work was also presented in the format of a public lecture, using the images as a way to illustrate and present in greater depth concepts of developmental biology. The fact that the storyline goes back and forth between scientific aspects, which may be more abstract, to images from daily life, which are readily appealing, keeps the audience alert and attracted to the lecture’s thread. Over the past year, I have given this lecture numerous times, in different continents and to very diverse audiences, from a lay audience including students and teachers, to scientists from different disciplines [see, for example, the lecture given at the European Molecular Biology Laboratory in 2012 (http://medias01-web.embl.de/Mediasite/Play/102f090bfa93473eb369a8c646a8d09c1d)]. The presentation proved to be highly effective for all audiences, again stimulating suggestions for new metaphors from the participants. At the outset, the most unpredictable audience was that of experts in developmental biology, as I was worried that this mode of presentation may seem trivial or over simplified. Here, I was pleasantly surprised, as the process of crystallizing complicated concepts to a single metaphor proved to be thought provoking, even for specialists.
 

Fig.3(small)
Figure 3- Exhibit at the Harvard Allston Education Portal, April 2012. Photo: B. Shilo.

 
 
Finally, I have written a popular book that will be published by Yale University Press in the coming year. The text of this book flows in a manner that is independent of the images, but hopefully the accompanying pictures will make the book more accessible and stimulating. The book is aimed first and foremost at people with little or no background in developmental biology who are curious to learn about embryonic development. Although not a textbook, it could also be used as a supplement to developmental biology courses at high school or college undergraduate level. In addition, it may stimulate students to photograph their own metaphors to the developmental concepts they study, and a web forum could be constructed to display and discuss these analogies. Finally, students who begin their research in developmental biology labs are initially swamped by literature related to their future research project. It may be instrumental and inspiring if in parallel they could also read a book that provides them with a ‘bird’s eye’ view of the field and the emerging concepts, to place their particular project in the context of the broader picture.
 
Taking a wider view, one can ask if this approach of using human metaphors can be extended further, and used to present other scientific topics and disciplines. I found the analogy between a cell and a human highly effective, giving a clear and consistent definition of the individual unit. One can easily envisage extending this approach to fields such as cellular immunology or cancer biology. It may become more challenging to define the ‘quantum’ entity that would be analogous to humans, when considering other scientific fields and disciplines. I am certain, however, that creative modes could be devised to extend analogies to the human world in new ways, in order to enhance the intuitive understanding of complex scientific principles in a broad range of disciplines.
 
 
 

Ben-Zion Shilo, Weizmann Institute of Science, Israel

 

Follow Benny’s lead and enter our outreach competition by finding your own science metaphor!

 

Thumbs up (2 votes)
Loading...

Tags:
Categories: Education, Images, Outreach

A Perfect Lab Leaving List

Posted by , on 4 December 2013

Say goodbye to the lab books. They may let you keep it. But usually, sadly, it must stay. Despite being illegible to anyone but you, and never mind the amusing cartoons. The best you can do is a photocopy. If like me you favour the ‘pop-up lab book’ approach to data recording, the job may look slightly daunting. Personally, my lab book is a three dimensional work of art. A photocopy is just not going to convey the essence of my meaning. Yet for many of us, the urge to copy large tracts of our lab books is irresistible.

Remove all those personal touches you took years to accumulate around you. You know the ones. We all have them. For example, I have in front of me right now:

A rainbow stress ball in the shape of a brain. Courtesy of some trade display, company long since forgotten
Ditto a rubber duck wearing a lab coat.
An amusing picture of a lemur that was sent to me during my Ph.D. and is now somewhat of a mascot
One of those fluffy microbes that got popular a while back that you could give to people and joke about gifting them with mono or Ebola. This one is a rather adorable fat cell.
Countless post-it notes with essential information nuggets such as passwords, chemical formulae, how to skip blank cells in Microsoft Excel and a choice selection of French vocabulary

Unbelievably, your successor is unlikely to treasure these as you have, so you may choose to bequeath them to the like-minded souls around you, or give them a one-way trip into the bin on top of the lab book copies.

Get rid of all your solutions. There is nothing more lonely than a collection of old buffers. Here’s a sad fact: no one really trusts your buffer. It’s a personal thing, this is my buffer, I made it, and in it I trust, even though I know you made your buffer exactly the same way and you look reasonably clean. But I’ve seen that amusing bit of fungal fluff you found in your media bottle that you’ve been nurturing on your shelf to see how big it gets and it’s nothing personal, but I’m going to make my own buffer. Incidentally, now is the time to also get rid of any of your own fungal media pets.

Vintage journal articles. Is it just me or does reading other people’s article copies feel weird? Pre-loved literature (scribbled notes are the worst), makes me terribly uncomfortable, to the extent that, shamefully, I will print another copy rather than read someone else’s vintage papers. At this point it may be kindest to consign the whole pile to the recycling bin and think seriously about planting some trees.

Wipe your hard drive. Copy your data, purge your personal stuff and make sure that novel you’ve been writing during ten minute incubations is safely out of the way. Because someone is going to inherit your computer and unless you want to give them a unprecedented window into your life via your old emails, it’s time to search and destroy.

Fridge stocks. Sadly, they will either go off or grow stuff. Possible exceptions are pricy or rare things like antibodies which you should put back where you found them immediately (see next point).

Freezer stocks. Are you the one who took the second last tube of that reagent from the communal box that time you were working really late at night and forgot to put it back? We’ve all been there. It’s time for us to do the walk of shame back to the freezer with all the expensive things we’ve been hoarding. Best done last thing with as few witnesses as possible.

Now walk over to the minus 80C freezer. That cold, frozen wasteland of very important and largely forgotten samples. Samples labelled 1-10, or something similarly inscrutable that doesn’t even make sense to you anymore since the day you tucked them down the side of a box rather than safely inside it because it was only going to be in there for a couple of days. It’s time to let go and move on to…

Liquid nitrogen stocks. The pinnacle of storage paranoia. Exercise some caution here (not just for the very real possibility of frostbite). Things in here are most likely expensive and temperamental and very, very useful. Often best to walk away quietly.

All the rest of your various samples that someone might use someday. If you don’t care for your name being taken in vain throughout the ages, it’s nice to treat your tubes to a label. With a date. And perhaps even a lab book reference. When it comes to your samples, is there any such thing as Too Much Information?

 

So you’ve cleaned out your desk, your fridge is empty, and apart from the frostbite, you’re in good shape. You may be slightly hung-over from the leaving party, and you’ve definitely got a giant novelty goodbye card. Congratulations, you’re the perfect leaver.

Thumbs up (12 votes)
Loading...

Categories: Lab Life

Job opening: PhD position Wnt signaling and stem cell biology

Posted by , on 3 December 2013

Closing Date: 15 March 2021

We have an opening for a PhD student at the University of Amsterdam in the Netherlands.

This research project will investigate the behaviour and control of Wnt-responsive stem cells in the mammary gland. You will be part of a young research team that uses a combination of in vivo and in vitro approaches to understand normal stem cell behaviour, with the ultimate goal of translating principles of developmental and stem cell biology to cancer research and regenerative medicine. Our lab has strong ties to the Wnt-signaling community and to the field of mammary gland biology and we are looking for an ambitious PhD candidate to strengthen our team.

To apply, please visit the vacancy website. If you have any further questions, please contact dr. Renée van Amerongen

Applications will be accepted until 10 December 2013.

Thumbs up (No Ratings Yet)
Loading...

Categories: Jobs